Space Ranger1.3 (latest), printed on 06/28/2022
The spaceranger count pipeline outputs an indexed BAM file containing position-sorted reads aligned to the genome and transcriptome. Reads aligned to the transcriptome across exon junctions in the genome have a large gap in its CIGAR string, such as 35M225N64M. Each read in this BAM file has Visium spot and molecular barcode information attached. Space Ranger modifies MAPQ values; see the MM tag below. The following assumes basic familiarity with the BAM format. More details on the the SAM/BAM standard are available online.
If the BAM files are not required, you can instruct spaceranger count to skip BAM file creation by providing the --no-bam option. See the count documention here for more information.
Some aspects of the BAM file are particular to formalin fixed paraffin embedded (FFPE) samples.
A read that multimaps to the reference transcriptome, but maps uniquely to a single probe, is confidently mapped to that probe and its gene. The mapping quality has the following meaning:
MAPQ | Description |
---|---|
255 | Both read halves map to the same probe. |
3 | Each read half maps to a different probe. |
1 | One read half maps to a probe and the other half does not. |
0 | Neither read half maps to a probe. |
The BAM tag pr:Z
reports a semicolon-separated list of probe IDs. See below for a detailed description.
Visium spot and molecular barcode information for each read is stored as TAG fields:
Tag | Type | Description |
---|---|---|
CB | Z | Visium spot barcode sequence that is error-corrected and confirmed against a list of known-good barcode sequences. |
CR | Z | Visium spot barcode sequence as reported by the sequencer. |
CY | Z | Visium spot barcode read quality. Phred scores as reported by sequencer. |
UB | Z | Visium molecular barcode sequence that is error-corrected among other molecular barcodes with the same spot barcode and gene alignment. |
UR | Z | Visium molecular barcode sequence as reported by the sequencer. |
UY | Z | Visium molecular barcode read quality. Phred scores as reported by sequencer. |
BC | Z | Sample index read. |
QT | Z | Sample index read quality. Phred scores as reported by sequencer. |
TR | Z | Trimmed sequence. Trailing sequence (if any) following the spot and molecular barcodes on Read 1. |
The spot barcode CB
tag includes a suffix with a dash separator followed by a number:
AGAATGGTCTGCAT-1
This number will always be one (1) in the current Space Ranger output.
The following tags are also present on reads that mapped to the genome and overlapped an exon by at least one base pair. A read may align to multiple transcripts and genes, but it is only considered confidently mapped to the transcriptome if it mapped to a single gene.
Tag | Type | Description |
---|---|---|
TX | Z | Present in reads aligned to the same strand as the transcripts in this semicolon-separated list that are compatible with this alignment. Transcripts are specified with the transcript_id key in the reference GTF attribute column. The format of each entry is [transcript_id],[strand][pos],[cigar] , where strand is either + or - , pos is the alignment offset in transcript coordinates, and cigar is the CIGAR string in transcript coordinates. |
AN | Z | Same as the TX tag, but for reads that are aligned to the antisense strand of annotated transcripts. |
GX | Z | Semicolon-separated list of gene IDs that are compatible with this alignment. Gene IDs are specified with the gene_id key in the reference GTF attribute column. |
GN | Z | Semicolon-separated list of gene names that are compatible with this alignment. Gene names are specified with gene_name key in the reference GTF attribute column. |
MM | i | Set to 1 if the genome-aligner (STAR) originally gave a MAPQ < 255 (it multi-mapped to the genome) and Space Ranger changed it to 255 because the read overlapped exactly one gene. |
RE | A | Single character indicating the region type of this alignment (E = exonic, N = intronic, I = intergenic). |
pr | Z | For Visium FFPE, a semicolon-separated list of probe IDs: one probe ID if both read halves align to the same probe, and two probe IDs if each read half aligns to a different probe, or NA if a read half does not align to a probe. |
pa | i | The number of poly-A nucleotides trimmed from the 3' end of read 2. Up to 10% mismatches are permitted. |
ts | i | The number of template switch oligo (TSO) nucleotides trimmed from the 5' end of read 2. Up to 3 mismatches are permitted. The 30-bp TSO sequence is AAGCAGTGGTATCAACGCAGAGTACATGGG . |
xf | i | Extra alignment flags. The bits of this tag are interpreted as follows:
|