Space Ranger, printed on 07/01/2022
The Probe Sets Overview includes the following files:
| File | Description |
|---|---|
| Probe set reference CSV file | This CSV file is a required input for Space Ranger to enable analysis of Visium FFPE data. It specifies the probe sequences used for probe alignment. |
| Probe off-target activity CSV | A CSV file that lists probes with predicted off-target activity, excluded from analysis by default. |
| Probe set BED file | A BED12 file that contains the sequences and genomic coordinates of the probes. This file can be used to visualize the probe locations in a genome browser and intersect probe locations with other data sources. |
| Probe set metadata TSV file | A TSV file that lists probes with additional information about gene name and description. |
Files containing information about individual probes have a column corresponding to the probe identifier (ID) that uniquely identifies each probe. Probe IDs take the following format:
gene_id|gene_name|probe_sequence_hash
For example, the probe for the gene TSPAN6 in the human whole transcriptome probe set, which has the Ensembl gene ID ENSG00000000003 in the GRCh38-2020-A reference, has the probe ID ENSG00000000003|TSPAN6|41ef80c.
A small number of probes whose ID includes the prefix DEPRECATED are excluded from analysis by default.
This CSV file is a required input for Space Ranger to enable analysis of Visium FFPE data. It specifies the sequences used as a reference for probe alignment and the gene ID associated with each probe. See a description of the --probe-set argument to spaceranger count in the spaceranger count documentation.
The following snippet is an example from a probe set reference CSV file:
#probe_set_file_format=1.0 #panel_name=Visium Human Transcriptome Probe Set #panel_type=predesigned #reference_genome=GRCh38 #reference_version=2020-A gene_id,probe_seq,probe_id,included ENSG00000000003,ATCTT[...]TGCTT,ENSG00000000003|TSPAN6|41ef80c,TRUE ENSG00000000005,ATGAC[...]AGTAA,ENSG00000000005|TNMD|f11e5fc,TRUE ENSG00000000419,TTGTA[...]TTCCT,ENSG00000000419|DPM1|73ef065,TRUE ENSG00000000457,CTTGA[...]GGAAT,ENSG00000000457|SCYL3|e327340,TRUE [ ... ]
The columns of this file are:
| Column Name | Description |
|---|---|
gene_id |
The Ensembl gene identifier targeted by the probe. |
probe_seq |
The nucleotide sequence of the probe, which is complementary to the transcript sequence. |
probe_id |
The probe identifier, whose format is described in Probe Identifier. |
included |
A TRUE/FALSE flag specifying whether the probe is included in the filtered counts matrix output or excluded by the probe filter. See --no-probe-filter command line argument of spaceranger count. All probes of a gene must be marked TRUE in the included column for that gene to be included. |
The file also contains a number of required metadata fields in the header in the format #key=value:
| Metadata Field | Description |
|---|---|
panel_name |
The name of the probe set. |
panel_type |
Always predesigned for predesigned probe sets. |
reference_genome |
The reference genome build used for probe design. |
reference_version |
The version of the Space Ranger reference transcriptome used for probe design. |
probe_set_file_format |
The version of the probe set file format specification that this file conforms to. |
This CSV file lists probes with predicted off-target activity identified by alignment to the reference transcriptome.
The following snippet is an example of a probe off-target activity CSV file:
probe_id,off_target_genes ENSG00000004455|AK2|9f34385,ENSG00000185839|AL035411.1;ENSG00000242272|AK2P2 ENSG00000004478|FKBP4|ed8be23,ENSG00000251463|FKBP4P1 ENSG00000005022|SLC25A5|e0d84d7,ENSG00000225347|SLC25A5P8;ENSG00000213673|SLC25A5P3;ENSG00000226421|SLC25A5P5;ENSG00000235064|SLC25A5P2;ENSG00000213332|SLC25A5P6;ENSG00000251078|SLC25A5P9 ENSG00000005075|POLR2J|e3cf54f,ENSG00000228049|POLR2J2;ENSG00000285437|POLR2J3;ENSG00000272655|POLR2J4 ENSG00000005889|ZFX|aad009d,ENSG00000067646|ZFY ENSG00000006625|GGCT|dea3f5e,ENSG00000232943|AL050321.1 ENSG00000006756|ARSD|0fd6410,ENSG00000225117|ARSDP1 ENSG00000008128|CDK11A|2d9087f,ENSG00000248333|CDK11B ENSG00000008324|SS18L2|cc126ff,ENSG00000232525|SS18L2P1 [ ... ]
The columns for this file are:
| Column Name | Description |
|---|---|
probe_id |
The ID of the probe with predicted off-target activity. |
off_target_genes |
A semicolon separated list of predicted off-target genes. For each off-target gene, the Ensembl gene ID and gene symbol are separated by a vertical bar. |
A BED12-formatted file that contains the sequences and genomic coordinates of the probes. This file may be used to visualize the probe locations with genome browsers like IGV (Integrated Genomics Viewer) and the UCSC Genome Browser or to intersect the probe locations with other genomic features of interest using tools like Bedtools.
The following snippet is from an example BED12 file:
chr1 69519 69569 ENSG00000186092|OR4F5|c4da86d 0 - 69519 69569 0 1 50 0 chr1 925956 926006 ENSG00000187634|SAMD11|87d23c4 0 - 925956 926006 0 1 50 0 chr1 958972 959022 ENSG00000188976|NOC2L|6b84612 0 + 958972 959022 0 1 50 0 chr1 963955 964005 ENSG00000187961|KLHL17|da46e9a 0 - 963955 964005 0 1 50 0 chr1 970295 970345 ENSG00000187583|PLEKHN1|848db4f 0 - 970295 970345 0 1 50 0 chr1 979664 979714 ENSG00000187642|PERM1|2aaf487 0 + 979664 979714 0 1 50 0 chr1 999353 999403 ENSG00000188290|HES4|cbe069d 0 + 999353 999403 0 1 50 0 chr1 1014261 1014311 ENSG00000187608|ISG15|8b560b9 0 - 1014261 1014311 0 1 50 0 chr1 1043324 1043374 ENSG00000188157|AGRN|f06ab24 0 - 1043324 1043374 0 1 50 0 chr1 1072173 1072223 ENSG00000237330|RNF223|522e0bc 0 + 1072173 1072223 0 1 50 0
The columns of BED12 files we provide are as follows (adapted from UCSC Genome Browser documentation):
| Column Name | Description |
|---|---|
chromosome |
Chromosome of the target gene. |
chromStart |
0-based start coordinate of the targeted sequence on the chromosome. |
chromEnd |
0-based non-inclusive end coordinate on the chromosome. |
name |
probe ID as described above. |
score |
Set to 0 for all entries. |
strand |
+ or - to indicate the strand of the targeted gene. |
thickStart |
The starting position at which the feature is drawn as a thick line in browsers (matches display of the corresponding transcript region). |
thickEnd |
The ending position at which the feature is drawn as a thick line in browsers (matches display of the corresponding transcript region). |
itemRgb |
Set to 0 for all entries. |
blockCount |
The number of blocks (continuous intervals). |
blockSizes |
Comma-separated list of the block sizes, contains blockCount entries. |
blockStarts |
Comma-separated list of block starts relative to chromStart column, contains blockCount entries. |
The BED12 format was chosen because it allows probes that span splice junctions to be conveniently represented on a single line and allows genome browsers to visualize links between regions of probes that are discontinuous in genomic space. Browsers such as UCSC Genome Browser or IGV will render BED12 files appropriately, similar to how transcripts in the genome are displayed.
This format is also well-supported by command-line tools. For example, bedtools provides a -split command-line flag for some subcommands to allow the individual blocks within each line of a BED12 file to be treated independently as needed. This can be useful for calculating intersections, for example, where you may be interested in intersections with the regions covered by the probes themselves rather than intersections with the entire genomic interval the probe coordinates span including intronic regions. bedtools also provides the subcommand bed12tobed6 for conversion of BED12 files to BED6 format -- in the resulting file each probe would appear on multiple lines when spanning one or more splice junctions.
This TSV file lists additional metadata information of gene name and description for the genes targeted by probes. The file contains all the columns from Probe set reference CSV file along with the additional two columns. This file does not list the DEPRECATED probes.
The following is the code and snippet from the human probe metadata TSV file:
$ column -t -s $'\t' Visium_Human_Transcriptome_Probe_Set_v1.0_GRCh38-2020-A.probe_metadata.tsv | less --chop-long-lines probe_id gene_id gene_name gene_description probe_seq included ENSG00000000003|TSPAN6|41ef80c ENSG00000000003 TSPAN6 tetraspanin 6 ATCTTGTCTACTGCATGGCTTCTATAATCTCCTGTAGAGTTATACTGCTT TRUE ENSG00000000005|TNMD|f11e5fc ENSG00000000005 TNMD tenomodulin ATGACTCGTCCTCCTTGGTAGCAGTATGGATATGGGTAGTAGCCTAGTAA TRUE ENSG00000000419|DPM1|73ef065 ENSG00000000419 DPM1 dolichyl-phosphate mannosyltransferase subunit 1, catalytic TTGTAGCGAGTTCCAGAGACAATATCAAAATTACCCTCCTTTTGCTTCCT TRUE ENSG00000000457|SCYL3|e327340 ENSG00000000457 SCYL3 SCY1 like pseudokinase 3 CTTGATTTCCAAGGCATAGACTCTTCAGTGAGTGAAAGCAAAGCAGGAAT TRUE
The columns of this file in order are:
| Column Name | Description |
|---|---|
probe_id |
Probe identifier, as included in Probe set reference CSV file. The format is described in Probe identifiers. |
gene_id |
The Ensembl gene identifier targeted by the probe, same as in Probe set reference CSV file. |
gene_name |
The official HGNC gene symbol targeted by the probe. |
gene_description |
The official HGNC gene full name targeted by the probe. |
probe_seq |
The nucleotide sequence of the probe, which is complementary to the transcript sequence, same as in Probe set reference CSV file. |
included |
A TRUE/FALSE flag specifying whether the probe is included in the filtered counts matrix output or excluded by the probe filter and is same as that in Probe set reference CSV file. See --no-probe-filter command line argument of spaceranger count. All probes of a gene must be marked TRUE in the included column for that gene to be included. |